Stem-loop sequence mml-mir-141

AccessionMI0002485 (change log)
DescriptionMacaca mulatta miR-141 stem-loop
Gene family MIPF0000019; mir-8
Literature search

1 open access papers mention mml-mir-141
(1 sentences)

Stem-loop
   u         u   u       --    u        -   ugg  ua 
5'  ggccggccc ggg ccaucuu  ccag acaguguu gga   uc  a
    ||||||||| ||| |||||||  |||| |||||||| |||   ||  u
3'  uuggcuggg ccc gguagaa  gguc ugucacaa ccu   ag  u
   u         c   c       au    -        u   cga  ug 
Get sequence
Deep sequencing
49717 reads, 278 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 7280874-7280968 [+]
antisense
ENSMMUT00000014255 ; LPCAT3-201; intron 1
Clustered miRNAs
< 10kb from mml-mir-141
mml-mir-200cchr11: 7280477-7280544 [+]
mml-mir-141chr11: 7280874-7280968 [+]
Database links

Mature sequence mml-miR-141-5p

Accession MIMAT0026561
Sequence

19 - 

ucuuccaguacaguguugga

 - 38

Get sequence
Deep sequencing177 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-141-3p

Accession MIMAT0002196
Sequence

60 - 

aacacugucugguaaagaugg

 - 80

Get sequence
Deep sequencing49536 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).