Stem-loop sequence mml-mir-200c

AccessionMI0002484 (change log)
DescriptionMacaca mulatta miR-200c stem-loop
Gene family MIPF0000019; mir-8
Literature search

2 open access papers mention mml-mir-200c
(2 sentences)

Stem-loop
     cu    -      a        u   u  ggu 
5' cc  cguc uuaccc gcaguguu ggg gc   u
   ||  |||| |||||| |||||||| ||| ||    
3' gg  guag aauggg cgucauaa cuc ug   g
     ag    u      c        u   -  agg 
Get sequence
Deep sequencing
101142 reads, 656 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 7280477-7280544 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-200c
mml-mir-200cchr11: 7280477-7280544 [+]
mml-mir-141chr11: 7280874-7280968 [+]
Database links

Mature sequence mml-miR-200c-5p

Accession MIMAT0026560
Sequence

5 - 

cgucuuacccagcaguguuugg

 - 26

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-200c-3p

Accession MIMAT0002195
Sequence

45 - 

aauacugccggguaaugaugga

 - 66

Get sequence
Deep sequencing101138 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).