Stem-loop sequence kshv-mir-K12-4

Accession

MI0002482

Description

Kaposi sarcoma-associated herpesvirus miR-K12-4 stem-loop

Stem-loop

    c      aa  g     c    --g    uu 
auaa uagcua  cc cagua ucua   ggca  c
|||| ||||||  || ||||| ||||   ||||   
uauu gucgau  gg gucau agau   uugu  a
    a      cc  a     a    aca    uu 

Comments

Samols et al. incorrectly named this sequence miR-3 [3]. Cai et al. define the likely miRNA primary transcripts in [4].

Genome context

• Coordinates (EMBL:U75698.1): KSU75698: 121413-121482 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from kshv-mir-K12-4

• kshv-mir-K12-1: KSU75698: 121847-121913 [-]
• kshv-miR-K12-2: KSU75698: 121674-121764 [-]
• kshv-mir-K12-3: KSU75698: 121544-121613 [-]
• kshv-mir-K12-4: KSU75698: 121413-121482 [-]
• kshv-mir-K12-5: KSU75698: 121263-121332 [-]
• kshv-mir-K12-6: KSU75698: 120761-120822 [-]
• kshv-mir-K12-11: KSU75698: 120576-120646 [-]
• kshv-mir-K12-7: KSU75698: 120355-120426 [-]
• kshv-mir-K12-8: KSU75698: 119943-120012 [-]
• kshv-mir-K12-9: KSU75698: 119300-119365 [-]
• kshv-mir-K12-10a: KSU75698: 117967-118036 [-]
• kshv-mir-K12-12: KSU75698: 117674-117771 [-]

Mature sequence kshv-miR-K12-4-5p

• Accession: MIMAT0002191
• Sequence: 7 - agcuaaaccgcaguacucuagg - 28
• Evidence: experimental; cloned [1-3,5], Solexa [6], SOLiD [7]
• Validated targets:
  • MIRTARBASE:kshv-miR-K12-4-5p
  • TARBASE:kshv-miR-K12-4-5p

Mature sequence kshv-miR-K12-4-3p

• Accession: MIMAT0002192
• Sequence: 45 - uagaauacugaggccuagcuga - 66
• Evidence: experimental; cloned [1-3,5], Solexa [6], SOLiD [7]
• Validated targets:
  • MIRTARBASE:kshv-miR-K12-4-3p
  • TARBASE:kshv-miR-K12-4-3p

References

1. PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
2. PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
3. PMID:15994824 "Cloning and identification of a microRNA cluster within the latency-associated region of Kaposi's sarcoma-associated herpesvirus" Samols MA, Hu J, Skalsky RL, Renne R J Virol. 79:9301-9305(2005).
4. PMID:16474131 "Transcriptional origin of Kaposi's sarcoma-associated herpesvirus microRNAs" Cai X, Cullen BR J Virol. 80:2234-2242(2006).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:19889781 "In-depth analysis of Kaposi's sarcoma-associated herpesvirus microRNA expression provides insights into the mammalian microRNA-processing machinery" Umbach JL, Cullen BR J Virol. 84:695-703(2010).
7. PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).