Stem-loop sequence kshv-mir-K12-5

AccessionMI0002481 (change log)
DescriptionKaposi sarcoma-associated herpesvirus miR-K12-5 stem-loop
Stem-loop
   u    ua    -  c  u   gc      g u  ac 
5'  gacc  ggua gu cc ggu  ccuaag g cu  a
    ||||  |||| || || |||  |||||| | ||   
3'  cugg  ccgu ca gg ccg  ggauuc c ga  u
   a    --    u  a  u   ua      a -  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Samols et al. incorrectly named this sequence miR-4 [3]. Cai et al. define the likely miRNA primary transcripts in [4].

Genome context
Coordinates (EMBL:U75698.1) Overlapping transcripts
KSU75698: 121263-121332 [-]
intergenic
Clustered miRNAs
< 10kb from kshv-mir-K12-5
kshv-mir-K12-1KSU75698: 121847-121913 [-]
kshv-miR-K12-2KSU75698: 121674-121764 [-]
kshv-mir-K12-3KSU75698: 121544-121613 [-]
kshv-mir-K12-4KSU75698: 121413-121482 [-]
kshv-mir-K12-5KSU75698: 121263-121332 [-]
kshv-mir-K12-6KSU75698: 120761-120822 [-]
kshv-mir-K12-11KSU75698: 120576-120646 [-]
kshv-mir-K12-7KSU75698: 120355-120426 [-]
kshv-mir-K12-8KSU75698: 119943-120012 [-]
kshv-mir-K12-9KSU75698: 119300-119365 [-]
kshv-mir-K12-10aKSU75698: 117967-118036 [-]
kshv-mir-K12-12KSU75698: 117674-117771 [-]
Database links

Mature sequence kshv-miR-K12-5-5p

Accession MIMAT0015218
Previous IDskshv-miR-K12-5*
Sequence

7 - 

agguagucccuggugcccuaagg

 - 29

Get sequence
Evidence experimental; Illumina [6], SOLiD [7]

Mature sequence kshv-miR-K12-5-3p

Accession MIMAT0002190
Previous IDskshv-miR-K12-5
Sequence

46 - 

uaggaugccuggaacuugccggu

 - 68

Get sequence
Evidence experimental; cloned [1-3,5], Illumina [6], SOLiD [7]

References

1
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
2
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
3
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
7
PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).