Stem-loop sequence kshv-mir-K12-6

Accession MI0002480
Description Kaposi sarcoma-associated herpesvirus miR-K12-6 stem-loop
Stem-loop
    uc       a  u  -u        gg 
cuug  cagcagc cc aa  ccaucggc  u
||||  ||||||| || ||  ||||||||   
gagc  guugucg gg uu  gguagucg  c
    ga       -  c  uu        gg 
Get sequence
Comments

Samols et al. incorrectly named this sequence miR-5 [3]. Cai et al. define the likely miRNA primary transcripts in [4].

Genome context
Coordinates (EMBL:U75698.1) Overlapping transcripts
KSU75698: 120761-120822 [-]
intergenic
Clustered miRNAs
< 10kb from kshv-mir-K12-6
kshv-mir-K12-1 KSU75698: 121847-121913 [-]
kshv-miR-K12-2 KSU75698: 121674-121764 [-]
kshv-mir-K12-3 KSU75698: 121544-121613 [-]
kshv-mir-K12-4 KSU75698: 121413-121482 [-]
kshv-mir-K12-5 KSU75698: 121263-121332 [-]
kshv-mir-K12-6 KSU75698: 120761-120822 [-]
kshv-mir-K12-11 KSU75698: 120576-120646 [-]
kshv-mir-K12-7 KSU75698: 120355-120426 [-]
kshv-mir-K12-8 KSU75698: 119943-120012 [-]
kshv-mir-K12-9 KSU75698: 119300-119365 [-]
kshv-mir-K12-10a KSU75698: 117967-118036 [-]
kshv-mir-K12-12 KSU75698: 117674-117771 [-]

Mature sequence kshv-miR-K12-6-5p

Accession MIMAT0002188
Sequence

6 - 

ccagcagcaccuaauccaucgg

 - 27

Get sequence
Evidence experimental; cloned [1-2,5], Solexa [6], SOLiD [7]
Validated targets

Mature sequence kshv-miR-K12-6-3p

Accession MIMAT0002189
Sequence

37 - 

ugaugguuuucgggcuguugag

 - 58

Get sequence
Evidence experimental; cloned [1-3,5], Solexa [6], SOLiD [7]
Validated targets

References

1
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
2
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
3
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
7
PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).