Stem-loop sequence kshv-mir-K12-8

Accession MI0002478
Description Kaposi sarcoma-associated herpesvirus miR-K12-8 stem-loop
Stem-loop 
    ca   c    c aa    --- c    uu u 
cgcg  cuc cuca u  cgcc   c gcuu  g c
||||  ||| |||| |  ||||   | ||||  | u
gcgc  gag gagu a  gcgg   g cgaa  u g
    ac   a    c gc    auc a    gg u
Get sequence
Comments

Cai et al. define the likely miRNA primary transcripts in [4].

Genome context
Coordinates (EMBL:U75698.1) Overlapping transcripts
KSU75698: 119943-120012 [-]
intergenic
Clustered miRNAs
< 10kb from kshv-mir-K12-8
kshv-mir-K12-1 KSU75698: 121847-121913 [-]
kshv-miR-K12-2 KSU75698: 121674-121764 [-]
kshv-mir-K12-3 KSU75698: 121544-121613 [-]
kshv-mir-K12-4 KSU75698: 121413-121482 [-]
kshv-mir-K12-5 KSU75698: 121263-121332 [-]
kshv-mir-K12-6 KSU75698: 120761-120822 [-]
kshv-mir-K12-11 KSU75698: 120576-120646 [-]
kshv-mir-K12-7 KSU75698: 120355-120426 [-]
kshv-mir-K12-8 KSU75698: 119943-120012 [-]
kshv-mir-K12-9 KSU75698: 119300-119365 [-]
kshv-mir-K12-10a KSU75698: 117967-118036 [-]
kshv-mir-K12-12 KSU75698: 117674-117771 [-]

Mature sequence kshv-miR-K12-8-5p

Accession MIMAT0015216
Previous IDs kshv-miR-K12-8*
Sequence

6 -  

acucccucacuaacgccccgcu

 - 27

Get sequence
Evidence experimental; Solexa [6], SOLiD [7]

Mature sequence kshv-miR-K12-8-3p

Accession MIMAT0002186
Previous IDs kshv-miR-K12-8
Sequence

46 -  

cuaggcgcgacugagagagca

 - 66

Get sequence
Evidence experimental; cloned [1-3,5], Solexa [6], SOLiD [7]

References

1
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
2
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
3
PMID:15994824 "Cloning and identification of a microRNA cluster within the latency-associated region of Kaposi's sarcoma-associated herpesvirus" Samols MA, Hu J, Skalsky RL, Renne R J Virol. 79:9301-9305(2005).
4
PMID:16474131 "Transcriptional origin of Kaposi's sarcoma-associated herpesvirus microRNAs" Cai X, Cullen BR J Virol. 80:2234-2242(2006).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:19889781 "In-depth analysis of Kaposi's sarcoma-associated herpesvirus microRNA expression provides insights into the mammalian microRNA-processing machinery" Umbach JL, Cullen BR J Virol. 84:695-703(2010).
7
PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).