Stem-loop sequence kshv-mir-K12-10b

AccessionMI0002473 (change log)
DescriptionKaposi sarcoma-associated herpesvirus miR-K12-10b stem-loop
Gene family MIPF0000261; mir-K12-10
Stem-loop
       ag        c    c     c     ugu 
5' cugg  gcuugggg gaua cacca ucguu   c
   ||||  |||||||| |||| ||||| |||||    
3' gacc  ugagcccc cugu guggu agcgg   u
       gg        c    u     u     uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Cai et al. define the likely miRNA primary transcripts in [3].

Database links

Mature sequence kshv-miR-K12-10b

Accession MIMAT0002180
Sequence

46 - 

ugguguuguccccccgaguggc

 - 67

Get sequence
Evidence experimental; cloned [1-2,4], Illumina [5], SOLiD [6]

References

1
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
2
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
6
PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).