Stem-loop sequence kshv-mir-K12-10a

AccessionMI0002472 (change log)
DescriptionKaposi sarcoma-associated herpesvirus miR-K12-10a stem-loop
Gene family MIPF0000261; mir-K12-10
Stem-loop
       ag        c    c   cac     ugu 
5' cugg  gcuugggg gaua cac   ucguu   c
   ||||  |||||||| |||| |||   |||||    
3' gacc  ugagcccc cugu gug   agcgg   u
       gg        c    u   auu     uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Cai et al. define the likely miRNA primary transcripts in [4].

Genome context
Coordinates (EMBL:U75698.1) Overlapping transcripts
KSU75698: 117967-118036 [-]
intergenic
Clustered miRNAs
< 10kb from kshv-mir-K12-10a
kshv-mir-K12-1KSU75698: 121847-121913 [-]
kshv-miR-K12-2KSU75698: 121674-121764 [-]
kshv-mir-K12-3KSU75698: 121544-121613 [-]
kshv-mir-K12-4KSU75698: 121413-121482 [-]
kshv-mir-K12-5KSU75698: 121263-121332 [-]
kshv-mir-K12-6KSU75698: 120761-120822 [-]
kshv-mir-K12-11KSU75698: 120576-120646 [-]
kshv-mir-K12-7KSU75698: 120355-120426 [-]
kshv-mir-K12-8KSU75698: 119943-120012 [-]
kshv-mir-K12-9KSU75698: 119300-119365 [-]
kshv-mir-K12-10aKSU75698: 117967-118036 [-]
kshv-mir-K12-12KSU75698: 117674-117771 [-]
Database links

Mature sequence kshv-miR-K12-10a-5p

Accession MIMAT0015212
Previous IDskshv-miR-K12-10a*
Sequence

6 - 

ggcuuggggcgauaccaccacu

 - 27

Get sequence
Evidence experimental; Illumina [6], SOLiD [7]

Mature sequence kshv-miR-K12-10a-3p

Accession MIMAT0002179
Previous IDskshv-miR-K12-10a
Sequence

46 - 

uaguguuguccccccgaguggc

 - 67

Get sequence
Evidence experimental; cloned [1-3,5], Illumina [6], SOLiD [7]

References

1
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
2
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
3
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
7
PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).