Stem-loop sequence kshv-mir-K12-10a

Accession

MI0002472

Description

Kaposi sarcoma-associated herpesvirus miR-K12-10a stem-loop

Gene family

MIPF0000261; mir-K12-10

Stem-loop

    ag        c    c   cac     ugu 
cugg  gcuugggg gaua cac   ucguu   c
||||  |||||||| |||| |||   |||||    
gacc  ugagcccc cugu gug   agcgg   u
    gg        c    u   auu     uug 

Comments

Cai et al. define the likely miRNA primary transcripts in [4].

Genome context

• Coordinates (EMBL:U75698.1): KSU75698: 117967-118036 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from kshv-mir-K12-10a

• kshv-mir-K12-1: KSU75698: 121847-121913 [-]
• kshv-miR-K12-2: KSU75698: 121674-121764 [-]
• kshv-mir-K12-3: KSU75698: 121544-121613 [-]
• kshv-mir-K12-4: KSU75698: 121413-121482 [-]
• kshv-mir-K12-5: KSU75698: 121263-121332 [-]
• kshv-mir-K12-6: KSU75698: 120761-120822 [-]
• kshv-mir-K12-11: KSU75698: 120576-120646 [-]
• kshv-mir-K12-7: KSU75698: 120355-120426 [-]
• kshv-mir-K12-8: KSU75698: 119943-120012 [-]
• kshv-mir-K12-9: KSU75698: 119300-119365 [-]
• kshv-mir-K12-10a: KSU75698: 117967-118036 [-]
• kshv-mir-K12-12: KSU75698: 117674-117771 [-]

Mature sequence kshv-miR-K12-10a-5p

• Accession: MIMAT0015212
• Previous IDs: kshv-miR-K12-10a*
• Sequence: 6 - ggcuuggggcgauaccaccacu - 27
• Evidence: experimental; Solexa [6], SOLiD [7]

Mature sequence kshv-miR-K12-10a-3p

• Accession: MIMAT0002179
• Previous IDs: kshv-miR-K12-10a
• Sequence: 46 - uaguguuguccccccgaguggc - 67
• Evidence: experimental; cloned [1-3,5], Solexa [6], SOLiD [7]

References

1. PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
2. PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
3. PMID:15994824 "Cloning and identification of a microRNA cluster within the latency-associated region of Kaposi's sarcoma-associated herpesvirus" Samols MA, Hu J, Skalsky RL, Renne R J Virol. 79:9301-9305(2005).
4. PMID:16474131 "Transcriptional origin of Kaposi's sarcoma-associated herpesvirus microRNAs" Cai X, Cullen BR J Virol. 80:2234-2242(2006).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:19889781 "In-depth analysis of Kaposi's sarcoma-associated herpesvirus microRNA expression provides insights into the mammalian microRNA-processing machinery" Umbach JL, Cullen BR J Virol. 84:695-703(2010).
7. PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).