|
miRBase |
|
Mature sequence hsa-miR-487a |
|
| Accession | MIMAT0002178 |
| Previous IDs | hsa-miR-487 |
| Sequence |
49 - aaucauacagggacauccaguu - 70 |
| Deep sequencing | 21 reads, 2 experiments |
| Evidence | experimental; cloned [1-3], Northern [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15978578
"Identification of human fetal liver miRNAs by a novel method"
FEBS Lett. 579:3849-3854(2005).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|