Stem-loop sequence hsa-mir-487a

AccessionMI0002471 (change log)
Previous IDshsa-mir-487
Symbol HGNC:MIR487A
DescriptionHomo sapiens miR-487a stem-loop
Gene family MIPF0000018; mir-154
Literature search

14 open access papers mention hsa-mir-487a
(32 sentences)

Stem-loop
         u     g   uua      c    -    c   a 
5' gguacu gaaga ugg   ucccug ugug uucg uua u
   |||||| ||||| |||   |||||| |||| |||| ||| u
3' cuauga uuuuu acc   agggac auac aagc agu u
         c     g   uac      -    u    -   a 
Get sequence
Deep sequencing
3143 reads, 0 reads per million, 103 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101052446-101052525 [+]
antisense
OTTHUMT00000414335 ; BEGAIN-006; intron 1
ENST00000554140 ; BEGAIN-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-487a
hsa-mir-1185-1chr14: 101042977-101043062 [+]
hsa-mir-1185-2chr14: 101044198-101044283 [+]
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
Database links

Mature sequence hsa-miR-487a-5p

Accession MIMAT0026559
Sequence

13 - 

gugguuaucccugcuguguucg

 - 34

Get sequence
Deep sequencing1217 reads, 75 experiments
Evidence experimental; Illumina [4]
Predicted targets

Mature sequence hsa-miR-487a-3p

Accession MIMAT0002178
Previous IDshsa-miR-487
Sequence

49 - 

aaucauacagggacauccaguu

 - 70

Get sequence
Deep sequencing1924 reads, 100 experiments
Evidence experimental; cloned [1-3], Northern [1], Illumina [4]
Database links
Predicted targets

References

1
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).