Stem-loop sequence hsa-mir-485

AccessionMI0002469
Symbol HGNC:MIR485
DescriptionHomo sapiens miR-485 stem-loop
Gene family MIPF0000201; mir-485
Stem-loop
      ug        cu       -    a    auuc 
5' acu  gagagagg  ggccgug auga uucg    a
   |||  ||||||||  ||||||| |||| ||||    u
3' uga  uucucucc  ucggcac uacu gagc    c
      uu        uc       a    -    gaaa 
Get sequence
Deep sequencing
2467 reads, 252 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr14: 101055419-101055491 [+]
antisense
OTTHUMT00000414339 ; CTD-2644I21.1-001; intron 1
ENST00000554540 ; CTD-2644I21.1-001; intron 1
Clustered miRNAs
< 10kb from hsa-mir-485
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
hsa-mir-541chr14: 101064495-101064578 [+]
hsa-mir-409chr14: 101065300-101065378 [+]
Database links

Mature sequence hsa-miR-485-5p

Accession MIMAT0002175
Sequence

9 - 

agaggcuggccgugaugaauuc

 - 30

Get sequence
Deep sequencing646 reads, 20 experiments
Evidence experimental; array-cloned [2], cloned [3]
Validated targets
Predicted targets

Mature sequence hsa-miR-485-3p

Accession MIMAT0002176
Sequence

46 - 

gucauacacggcucuccucucu

 - 67

Get sequence
Deep sequencing565 reads, 13 experiments
Evidence experimental; cloned [1,3], array-cloned [2]
Validated targets
Predicted targets

References

1
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
2
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).