|
miRBase |
|
Stem-loop sequence hsa-mir-484 |
|||||
| Accession | MI0002468 | ||||
| Symbol | HGNC:MIR484 | ||||
| Description | Homo sapiens miR-484 stem-loop | ||||
| Gene family | MIPF0000219; mir-484 | ||||
| Stem-loop |
a ----uc cuca c au -c a gcc gucagg guc ccucccg aaa cccu a ||| |||||| ||| ||||||| ||| |||| cgg cggucc cag ggggggc uuu ggga a g uuuuuu ---- u cc ca u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-484 |
|
| Accession | MIMAT0002174 |
| Sequence |
8 - ucaggcucaguccccucccgau - 29 |
| Deep sequencing | 694 reads, 24 experiments |
| Evidence | experimental; cloned [1-3], Northern [1] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15978578
"Identification of human fetal liver miRNAs by a novel method"
FEBS Lett. 579:3849-3854(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|