Stem-loop sequence hsa-mir-484

AccessionMI0002468
Symbol HGNC:MIR484
DescriptionHomo sapiens miR-484 stem-loop
Gene family MIPF0000219; mir-484
Stem-loop
   a   ----uc      cuca   c       au   -c    a 
5'  gcc      gucagg    guc ccucccg  aaa  cccu a
    |||      ||||||    ||| |||||||  |||  ||||  
3'  cgg      cggucc    cag ggggggc  uuu  ggga a
   g   uuuuuu      ----   u       cc   ca    u 
Get sequence
Deep sequencing
4522 reads, 1.36e+03 reads per million, 68 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr16: 15643294-15643372 [+]
sense
OTTHUMT00000422461 ; C16orf45-009; intron 1
OTTHUMT00000422462 ; C16orf45-010; intron 1
OTTHUMT00000252130 ; C16orf45-001; intron 2
OTTHUMT00000422455 ; C16orf45-004; intron 2
OTTHUMT00000422459 ; C16orf45-011; intron 2
OTTHUMT00000422460 ; C16orf45-002; intron 2
OTTHUMT00000422457 ; C16orf45-006; intron 3
OTTHUMT00000422458 ; C16orf45-007; intron 3
ENST00000564389 ; C16orf45-009; intron 1
ENST00000561692 ; C16orf45-010; intron 1
ENST00000300006 ; C16orf45-001; intron 2
ENST00000566490 ; C16orf45-004; intron 2
ENST00000567550 ; C16orf45-011; intron 2
ENST00000452191 ; C16orf45-002; intron 2
ENST00000570249 ; C16orf45-006; intron 3
ENST00000561813 ; C16orf45-007; intron 3
Database links

Mature sequence hsa-miR-484

Accession MIMAT0002174
Sequence

8 - 

ucaggcucaguccccucccgau

 - 29

Get sequence
Deep sequencing394 reads, 44 experiments
Evidence experimental; cloned [1-3], Northern [1]
Validated targets
Predicted targets

References

1
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).