Stem-loop sequence hsa-mir-483

AccessionMI0002467 (change log)
Symbol HGNC:MIR483
DescriptionHomo sapiens miR-483 stem-loop
Gene family MIPF0000180; mir-483
Stem-loop
         -             a  a  g   -u   ucc 
5' gagggg gaagacgggagga ag ag gag  ggu   a
   |||||| ||||||||||||| || || |||  |||    
3' cucucc cuucugcccuccu uc uc cuc  ccg   u
         u             c  c  a   cu   cac 
Get sequence
Deep sequencing
12787 reads, 171 reads per million, 58 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 2134134-2134209 [-]
intergenic
Database links

Mature sequence hsa-miR-483-5p

Accession MIMAT0004761
Sequence

8 - 

aagacgggaggaaagaagggag

 - 29

Get sequence
Deep sequencing6495 reads, 53 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-483-3p

Accession MIMAT0002173
Previous IDshsa-miR-483
Sequence

48 - 

ucacuccucuccucccgucuu

 - 68

Get sequence
Deep sequencing6268 reads, 37 experiments
Evidence experimental; cloned [1-2], Northern [1]
Database links
Predicted targets

References

1
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).