|
miRBase |
|
Stem-loop sequence hsa-mir-410 |
|||||
| Accession | MI0002465 | ||||
| Symbol | HGNC:MIR410 | ||||
| Description | Homo sapiens miR-410 stem-loop | ||||
| Gene family | MIPF0000018; mir-154 | ||||
| Stem-loop |
c g ug a a - uuuu gguac ugagaa aggu ucugug ug guucg c a ||||| |||||| |||| |||||| || ||||| | ccaug acuuuu uccg agacac au uaagc g u - g gu a a a uaau |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-410 |
|
| Accession | MIMAT0002171 |
| Sequence |
50 - aauauaacacagauggccugu - 70 |
| Deep sequencing | 104 reads, 4 experiments |
| Evidence | experimental; array-cloned [2], cloned [3-5], Northern [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
| 2 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 3 |
PMID:15978578
"Identification of human fetal liver miRNAs by a novel method"
FEBS Lett. 579:3849-3854(2005).
|
| 4 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|