Stem-loop sequence hsa-mir-410

AccessionMI0002465 (change log)
Symbol HGNC:MIR410
DescriptionHomo sapiens miR-410 stem-loop
Gene family MIPF0000018; mir-154
Literature search

59 open access papers mention hsa-mir-410
(629 sentences)

Stem-loop
        c      g    ug      a  a     - uuuu 
5' gguac ugagaa aggu  ucugug ug guucg c    a
   ||||| |||||| ||||  |||||| || ||||| |     
3' ccaug acuuuu uccg  agacac au uaagc g    u
        -      g    gu      a  a     a uaau 
Get sequence
Deep sequencing
8634 reads, 12.8 reads per million, 117 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101065912-101065991 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-410
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
hsa-mir-541chr14: 101064495-101064578 [+]
hsa-mir-409chr14: 101065300-101065378 [+]
hsa-mir-412chr14: 101065447-101065537 [+]
hsa-mir-369chr14: 101065598-101065667 [+]
hsa-mir-410chr14: 101065912-101065991 [+]
hsa-mir-656chr14: 101066724-101066801 [+]
Database links

Mature sequence hsa-miR-410-5p

Accession MIMAT0026558
Sequence

14 - 

agguugucugugaugaguucg

 - 34

Get sequence
Deep sequencing64 reads, 20 experiments
Evidence experimental; Illumina [6]
Predicted targets

Mature sequence hsa-miR-410-3p

Accession MIMAT0002171
Sequence

50 - 

aauauaacacagauggccugu

 - 70

Get sequence
Deep sequencing8568 reads, 116 experiments
Evidence experimental; array-cloned [2], cloned [3-5], Northern [3], Illumina [6]
Database links
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).