Stem-loop sequence ssc-mir-9-1

AccessionMI0002462 (change log)
DescriptionSus scrofa miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

10 open access papers mention ssc-mir-9-1
(58 sentences)

Stem-loop
   c       guug   uc               g      u  ug 
5'  gggguug    uua  uuugguuaucuagcu uaugag gg  u
    |||||||    |||  ||||||||||||||| |||||| ||  g
3'  ccccaau    aau  aagccaauagaucga auacuu cu  g
   a       -aaa   ga               a      -  ga 
Get sequence
Deep sequencing
1014 reads, 15.4 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr4: 102543210-102543298 [-]
antisense
ENSSSCT00000023060 ; ssc-mir-9-1.1-201; exon 1
Database links

Mature sequence ssc-miR-9-1

Accession MIMAT0002168
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing784 reads, 13 experiments
Evidence experimental; 454 [2], Illumina [3-4]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).