Stem-loop sequence ssc-mir-30c-2

AccessionMI0002461 (change log)
Previous IDsssc-mir-30c
DescriptionSus scrofa miR-30c-2 stem-loop
Gene family MIPF0000005; mir-30
Literature search

17 open access papers mention ssc-mir-30c-2
(34 sentences)

Stem-loop
   --ga    uacu       u   aca         guggaa 
5'     caga    guaaaca ccu   cucucagcu      a
       ||||    ||||||| |||   |||||||||       
3'     gucu    cauuugu gga   gagggucga      g
   uucc    cucu       c   --a         aagaau 
Get sequence
Deep sequencing
8311 reads, 1.44e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 57721688-57721767 [-]
intergenic
chrUScaf3160: 226517-226596 [+]
intergenic
Database links

Mature sequence ssc-miR-30c-5p

Accession MIMAT0002167
Previous IDsssc-miR-30c
Sequence

10 - 

uguaaacauccuacacucucagc

 - 32

Get sequence
Deep sequencing20344 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2-3]

Mature sequence ssc-miR-30c-3p

Accession MIMAT0022922
Sequence

50 - 

cugggagaaggcuguuuacucu

 - 71

Get sequence
Deep sequencing62 reads, 10 experiments
Evidence experimental; Illumina [5]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
3
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
5
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
6
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).