Stem-loop sequence ssc-mir-21

AccessionMI0002459 (change log)
DescriptionSus scrofa miR-21 stem-loop
Gene family MIPF0000060; mir-21
Literature search

43 open access papers mention ssc-mir-21
(319 sentences)

Stem-loop
   u      ccu      gu        a     a     a    u a 
5'  guacca   ugucgg  agcuuauc gacug uguug cugu g a
    ||||||   ||||||  |||||||| ||||| ||||| |||| | u
3'  uauggu   acaguc  ucggguag cugac acaac ggua c c
   c      uuu      ug        -     g     -    - u 
Get sequence
Deep sequencing
300767 reads, 7.72e+04 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 37340385-37340476 [+]
sense
OTTSUST00000001811 ; TMEM49-001; exon 12
ENSSSCT00000019232 ; ssc-mir-21.1-001; exon 12
Database links

Mature sequence ssc-miR-21-5p

Accession MIMAT0002165
Sequence

18 - 

uagcuuaucagacugauguuga

 - 39

Get sequence
Deep sequencing300461 reads, 15 experiments
Evidence experimental; cloned [2,5], 454 [3], Illumina [4,6-7]

Mature sequence ssc-miR-21-3p

Accession MIMAT0037322
Sequence

56 - 

caacagcagucgaugggcugu

 - 76

Get sequence
Deep sequencing292 reads, 11 experiments
Evidence experimental; Illumina [8]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
3
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
4
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
5
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
6
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
7
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
8
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).