Stem-loop sequence ssc-mir-204

AccessionMI0002458 (change log)
DescriptionSus scrofa miR-204 stem-loop
Gene family MIPF0000042; mir-204
Literature search

12 open access papers mention ssc-mir-204
(121 sentences)

Stem-loop
   ggcua    ccuucucau     ucg     u          a     u    gagaau 
5'      cagu         gugac   uggac ucccuuuguc uccua gccu      a
        ||||         |||||   ||||| |||||||||| ||||| ||||      u
3'      guca         uacug   acuug agggaaacgg agggu cgga      a
   ---cg    --------c     uua     c          a     -    ggaagu 
Get sequence
Deep sequencing
161 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 250527017-250527125 [-]
sense
Database links

Mature sequence ssc-miR-204

Accession MIMAT0002164
Sequence

32 - 

uucccuuugucauccuaugccu

 - 53

Get sequence
Deep sequencing157 reads, 11 experiments
Evidence experimental; 454 [2], Illumina [3-5]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
3
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).