Stem-loop sequence ssc-mir-196a-2

AccessionMI0002457 (change log)
Previous IDsssc-mir-196;ssc-mir-196a
DescriptionSus scrofa miR-196a-2 stem-loop
Gene family MIPF0000031; mir-196
Literature search

16 open access papers mention ssc-mir-196a-2
(103 sentences)

Stem-loop
   ----------uugcuca     uc                  a          a ug   
5'                  gcuga  uguggcuuagguaguuuc uguuguuggg u  ag 
                    |||||  |||||||||||||||||| |||||||||| |  | u
3'                  ugacu  acauugaguccgucaaag acaacggcuc a  uu 
   cgggagcugcuauuggc     --                  a          a gu   
Get sequence
Deep sequencing
15 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr5: 19654956-19655062 [-]
intergenic
Database links

Mature sequence ssc-miR-196a

Accession MIMAT0002163
Previous IDsssc-miR-196
Sequence

22 - 

uagguaguuucauguuguuggg

 - 43

Get sequence
Deep sequencing15 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).