Stem-loop sequence ssc-mir-186

AccessionMI0002456 (change log)
DescriptionSus scrofa miR-186 stem-loop
Gene family MIPF0000109; mir-186
Literature search

5 open access papers mention ssc-mir-186
(8 sentences)

Stem-loop
   ugcuuau                 u     u      uau  uu 
5'        aacuuuccaaagaauuc ccuuu gggcuu   ga  u
          ||||||||||||||||| ||||| ||||||   ||   
3'        uugaaggguuuuuuaag ggaaa cccgaa   uu  u
   -----gu                 u     -      --u  ua 
Get sequence
Deep sequencing
7786 reads, 1.08e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 131558966-131559047 [+]
sense
ENSSSCT00000004190 ; ZRANB2-201; intron 8
Database links

Mature sequence ssc-miR-186-5p

Accession MIMAT0002162
Sequence

15 - 

caaagaauucuccuuuugggcuu

 - 37

Get sequence
Deep sequencing7779 reads, 15 experiments
Evidence experimental; Illumina [2-4]

Mature sequence ssc-miR-186-3p

Accession MIMAT0037321
Sequence

54 - 

gcccaaaggugaauuuuuuggg

 - 75

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; Illumina [5]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
5
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).