Stem-loop sequence ssc-mir-18a

AccessionMI0002455 (change log)
Previous IDsssc-mir-18
DescriptionSus scrofa miR-18a stem-loop
Gene family MIPF0000001; mir-17
Literature search

18 open access papers mention ssc-mir-18a
(50 sentences)

Stem-loop
   ---gu         u   --   u   uc   u    a   -  aa u 
5'      gcuuuuugu cua  agg gca  uag gcag uag ug  g a
        ||||||||| |||  ||| |||  ||| |||| ||| ||  | g
3'      ugaagaaua ggu  ucc cgu  auc cguc auc ac  u a
   uguau         c   cu   u   ga   c    -   u  ga u 
Get sequence
Deep sequencing
603 reads, 73.3 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr11: 66610195-66610286 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-18a
ssc-mir-17chr11: 66610060-66610136 [+]
ssc-mir-18achr11: 66610195-66610286 [+]
ssc-mir-19achr11: 66610343-66610424 [+]
ssc-mir-20achr11: 66610513-66610583 [+]
ssc-mir-19b-1chr11: 66610642-66610721 [+]
ssc-mir-92a-1chr11: 66610762-66610841 [+]
Database links

Mature sequence ssc-miR-18a

Accession MIMAT0002161
Previous IDsssc-miR-18
Sequence

14 - 

uaaggugcaucuagugcagaua

 - 35

Get sequence
Deep sequencing596 reads, 15 experiments
Evidence experimental; cloned [2], Illumina [3-4]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).