Stem-loop sequence ssc-mir-139

AccessionMI0002453 (change log)
DescriptionSus scrofa miR-139 stem-loop
Gene family MIPF0000117; mir-139
Literature search

5 open access papers mention ssc-mir-139
(22 sentences)

Stem-loop
   gug       -   u  a            g gg 
5'    uauucua cag gc cgugucuccagu u  c
      ||||||| ||| || |||||||||||| |  u
3'    augaggu guc cg gcgcagaggucg a  c
   -ca       u   c  -            g gg 
Get sequence
Deep sequencing
493 reads, 6.67 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 7935635-7935702 [-]
intergenic
Database links

Mature sequence ssc-miR-139-5p

Accession MIMAT0002159
Previous IDsssc-miR-139
Sequence

7 - 

ucuacagugcacgugucuccag

 - 28

Get sequence
Deep sequencing416 reads, 14 experiments
Evidence experimental; Illumina [2,4-5], cloned [3]

Mature sequence ssc-miR-139-3p

Accession MIMAT0022921
Sequence

43 - 

uggagacgcggcccuguuggagu

 - 65

Get sequence
Deep sequencing77 reads, 15 experiments
Evidence experimental; Illumina [4]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).