Stem-loop sequence ssc-mir-136

AccessionMI0002452 (change log)
DescriptionSus scrofa miR-136 stem-loop
Gene family MIPF0000099; mir-136
Literature search

7 open access papers mention ssc-mir-136
(26 sentences)

Stem-loop
   u        g        c     uuu          uuc 
5'  gagcccuc gaggacuc auuug   ugaugaugga   u
    |||||||| |||||||| |||||   ||||||||||   u
3'  cuugggag cuucugag uaaac   gcuacuaccu   a
   u        a        -     ucu          cgc 
Get sequence
Deep sequencing
163 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 132079194-132079275 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-136
ssc-mir-493chr7: 132069400-132069482 [-]
ssc-mir-432chr7: 132079003-132079082 [+]
ssc-mir-136chr7: 132079194-132079275 [+]
Database links

Mature sequence ssc-miR-136-5p

Accession MIMAT0002158
Sequence

15 - 

acuccauuuguuuugaugaugga

 - 37

Get sequence
Deep sequencing50 reads, 9 experiments
Evidence experimental; Illumina [2-3]

Mature sequence ssc-miR-136-3p

Accession MIMAT0037320
Sequence

49 - 

caucaucgucucaaaugagucu

 - 70

Get sequence
Deep sequencing113 reads, 12 experiments
Evidence experimental; Illumina [4]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).