Stem-loop sequence ssc-mir-128-1

AccessionMI0002451 (change log)
Previous IDsssc-mir-128a;ssc-mir-128
DescriptionSus scrofa miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Literature search

9 open access papers mention ssc-mir-128-1
(14 sentences)

Stem-loop
   u    u      uuc       uag      cu       u 
5'  gagc guugga   ggggccg   cacugu  gagaggu u
    |||| ||||||   |||||||   ||||||  |||||||  
3'  uucg cgacuu   cucuggc   gugaca  cucuuua a
   c    u      uuu       caa      --       c 
Get sequence
Deep sequencing
573 reads, 6.67 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr15: 18661614-18661695 [-]
sense
ENSSSCT00000017092 ; R3HDM1-201; intron 18
Database links

Mature sequence ssc-miR-128

Accession MIMAT0002157
Previous IDsssc-miR-128a
Sequence

50 - 

ucacagugaaccggucucuuu

 - 70

Get sequence
Deep sequencing1386 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
3
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
5
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
6
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).