Stem-loop sequence ssc-mir-103-1

AccessionMI0002448 (change log)
Previous IDsssc-mir-103
DescriptionSus scrofa miR-103-1 stem-loop
Gene family MIPF0000024; mir-103
Literature search

24 open access papers mention ssc-mir-103-1
(67 sentences)

Stem-loop
       c    c  --    u  u           c   u g a 
5' cuua ugcc uc  ggcu cu uacagugcugc uug u c u
   |||| |||| ||  |||| || ||||||||||| ||| | |  
3' gagu acgg ag  ucgg ga auguuacgacg aac a g a
       c    a  ua    -  c           -   u g u 
Get sequence
Deep sequencing
20731 reads, 3.59e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr16: 59912617-59912698 [+]
sense
ENSSSCT00000018526 ; PANK3-201; intron 4
Database links

Mature sequence ssc-miR-103

Accession MIMAT0002154
Sequence

50 - 

agcagcauuguacagggcuauga

 - 72

Get sequence
Deep sequencing41499 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).