Stem-loop sequence ssc-let-7f-1

AccessionMI0002446 (change log)
Previous IDsssc-let-7f
DescriptionSus scrofa let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

47 open access papers mention ssc-let-7f-1
(226 sentences)

Stem-loop
   u      u   gu                uuagggucauac 
5'  guggga gag  aguagauuguauaguu            c
    |||||| |||  ||||||||||||||||             
3'  cacccu uuc  ucaucugacauaucaa            c
   g      -   ug                uagagguucuac 
Get sequence
Deep sequencing
91733 reads, 4.4e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 51801728-51801810 [-]
sense
OTTSUST00000011401 ; HUWE1-001; intron 60
ENSSSCT00000032330 ; HUWE1-201; intron 59
ENSSSCT00000013481 ; HUWE1-202; intron 59
ENSSSCT00000035055 ; HUWE1-001; intron 60
Clustered miRNAs
< 10kb from ssc-let-7f-1
ssc-let-7f-1chrX: 51801728-51801810 [-]
ssc-mir-98chrX: 51800864-51800943 [-]
Database links

Mature sequence ssc-let-7f-5p

Accession MIMAT0002152
Sequence

8 - 

ugagguaguagauuguauaguu

 - 29

Get sequence
Deep sequencing153350 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).