Stem-loop sequence ssc-let-7c

AccessionMI0002445 (change log)
DescriptionSus scrofa let-7c stem-loop
Gene family MIPF0000002; let-7
Literature search

42 open access papers mention ssc-let-7c
(136 sentences)

Stem-loop
   u      a      uu   g   u             ua  g ua a 
5'  gugugc uccggg  gag uag agguuguaugguu  ga u  c c
    |||||| ||||||  ||| ||| |||||||||||||  || |  | c
3'  cacacg agguuc  uuc auc uccaacaugucaa  uu a  g g
   u      -      cu   g   u             --  g gg u 
Get sequence
Deep sequencing
62774 reads, 3.24e+04 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr13: 191559336-191559429 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-let-7c
ssc-mir-99achr13: 191558610-191558689 [+]
ssc-let-7cchr13: 191559336-191559429 [+]
Database links

Mature sequence ssc-let-7c

Accession MIMAT0002151
Sequence

16 - 

ugagguaguagguuguaugguu

 - 37

Get sequence
Deep sequencing62757 reads, 16 experiments
Evidence experimental; 454 [2], Illumina [3,5-6], cloned [4]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
3
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
5
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
6
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).