Stem-loop sequence ssc-mir-325

AccessionMI0002444 (change log)
DescriptionSus scrofa miR-325 stem-loop
Gene family MIPF0000147; mir-325
Literature search

3 open access papers mention ssc-mir-325
(7 sentences)

Stem-loop
   --------------           cc   u                uu gug 
5'               agugcuugguu  uag agguguucaguaagug  u   a
                 |||||||||||  ||| ||||||||||||||||  |    
3'               ucacgaacuaa  auc uccacgaguuauuugc  a   c
   ggucuuggaucgug           cu   c                uu aua 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 69436727-69436820 [+]
intergenic
chrX: 69673008-69673101 [-]
intergenic
Database links

Mature sequence ssc-miR-325

Accession MIMAT0002150
Sequence

12 - 

ccuaguagguguucaguaagugu

 - 34

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence by similarity; MI0000596

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).