Stem-loop sequence ssc-mir-214

AccessionMI0002441 (change log)
DescriptionSus scrofa miR-214 stem-loop
Gene family MIPF0000062; mir-214
Literature search

25 open access papers mention ssc-mir-214
(65 sentences)

Stem-loop
   ggccu      acgga           u          aca            aacau 
5'      ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
        ||||||     ||||||||||| ||||||||||   ||||||||||||     c
3'      ccgacc     caacaguacac gacggacaga   ggacgacauguc     g
   ----u      -----           u          cac            cacuc 
Get sequence
Deep sequencing
3176 reads, 160 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 126099461-126099570 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-214
ssc-mir-199a-1chr9: 126105251-126105326 [-]
ssc-mir-214chr9: 126099461-126099570 [-]
Database links

Mature sequence ssc-miR-214-5p

Accession MIMAT0037318
Sequence

30 - 

ugccugucuacacuugcugugc

 - 51

Get sequence
Deep sequencing126 reads, 13 experiments
Evidence experimental; Illumina [3]

Mature sequence ssc-miR-214-3p

Accession MIMAT0002147
Sequence

71 - 

acagcaggcacagacaggcag

 - 91

Get sequence
Deep sequencing3034 reads, 15 experiments
Evidence experimental; Illumina [2]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).