Stem-loop sequence ssc-mir-205

AccessionMI0002440 (change log)
DescriptionSus scrofa miR-205 stem-loop
Gene family MIPF0000058; mir-205
Literature search

7 open access papers mention ssc-mir-205
(14 sentences)

Stem-loop
         uc           c        ucuca 
5' cucuug  cuucauuccac ggagucug     u
   ||||||  ||||||||||| ||||||||     a
3' gaggac  gaagugaggug cuuuagac     c
         uc           a        caacc 
Get sequence
Deep sequencing
33 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 146808292-146808360 [-]
intergenic
Database links

Mature sequence ssc-miR-205

Accession MIMAT0002146
Sequence

7 - 

uccuucauuccaccggagucug

 - 28

Get sequence
Deep sequencing32 reads, 10 experiments
Evidence experimental; 454 [2], Illumina [3-4]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).