Stem-loop sequence ssc-mir-183

AccessionMI0002439 (change log)
DescriptionSus scrofa miR-183 stem-loop
Gene family MIPF0000066; mir-183
Literature search

9 open access papers mention ssc-mir-183
(26 sentences)

Stem-loop
       g      --ac     ga        --   ac 
5' cugu uauggc    uggua  auucacug  uga  a
   |||| ||||||    |||||  ||||||||  |||   
3' gaca auaccg    gccau  uaagugac  gcu  g
       a      ggaa     --        ug   cu 
Get sequence
Deep sequencing
4531 reads, 740 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr18: 20030651-20030720 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-183
ssc-mir-183chr18: 20030651-20030720 [+]
ssc-mir-96chr18: 20030888-20030972 [+]
ssc-mir-182chr18: 20035212-20035295 [+]
Database links

Mature sequence ssc-miR-183

Accession MIMAT0002145
Sequence

6 - 

uauggcacugguagaauucacug

 - 28

Get sequence
Deep sequencing4530 reads, 15 experiments
Evidence experimental; Illumina [2-3]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).