Stem-loop sequence ssc-mir-181c

AccessionMI0002438 (change log)
DescriptionSus scrofa miR-181c stem-loop
Gene family MIPF0000007; mir-181
Literature search

24 open access papers mention ssc-mir-181c
(65 sentences)

Stem-loop
   caa      g    aa        cu       a     ggca 
5'    ggguuu gggg  cauucaac  gucggug guuug    g
      |||||| ||||  ||||||||  ||||||| |||||    c
3'    uccgga cccc  gugaguug  cagcuac caaac    u
   agg      g    ag        -c       -     ggac 
Get sequence
Deep sequencing
3165 reads, 407 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 65553664-65553750 [-]
sense
ENSSSCT00000021143 ; ssc-mir-181c.1-201; exon 1
Clustered miRNAs
< 10kb from ssc-mir-181c
ssc-mir-181cchr2: 65553664-65553750 [-]
ssc-mir-181dchr2: 65553487-65553566 [-]
Database links

Mature sequence ssc-miR-181c

Accession MIMAT0002144
Sequence

15 - 

aacauucaaccugucggugagu

 - 36

Get sequence
Deep sequencing2947 reads, 15 experiments
Evidence experimental; Illumina [2-4]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).