Stem-loop sequence ssc-mir-140

AccessionMI0002437 (change log)
DescriptionSus scrofa miR-140 stem-loop
Gene family MIPF0000085; mir-140
Literature search

16 open access papers mention ssc-mir-140
(33 sentences)

Stem-loop
       -  a             a       uu   uc 
5' ccug cc gugguuuuacccu ugguagg  acg  a
   |||| || ||||||||||||| |||||||  |||   
3' ggac gg caccaagauggga accaucu  ugu  u
       a  -             c       --   cg 
Get sequence
Deep sequencing
15914 reads, 1.68e+03 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf726: 107288-107357 [+]
intergenic
Database links

Mature sequence ssc-miR-140-5p

Accession MIMAT0002143
Previous IDsssc-miR-140
Sequence

7 - 

agugguuuuacccuaugguag

 - 27

Get sequence
Deep sequencing2082 reads, 15 experiments
Evidence experimental; cloned [2], Illumina [3]

Mature sequence ssc-miR-140-3p

Accession MIMAT0006786
Previous IDsssc-miR-140*
Sequence

45 - 

uaccacaggguagaaccacggac

 - 67

Get sequence
Deep sequencing13829 reads, 15 experiments
Evidence experimental; cloned [2], Illumina [3-4]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
3
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).