Stem-loop sequence ssc-mir-7-2

AccessionMI0002435 (change log)
Previous IDsssc-mir-7
DescriptionSus scrofa miR-7-2 stem-loop
Gene family MIPF0000022; mir-7
Literature search

12 open access papers mention ssc-mir-7-2
(22 sentences)

Stem-loop
   ---    u  -      a  u        a     a       u      --     a 
5'    ugga gu uggucu gu cugugugg agacu gugauuu guuguu  uuuag u
      |||| || |||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'    aucu cg accgga ca gguauacc ucuga cacuaaa caacag  aaauc a
   gac    c  u      -  c        g     -       -      cu     a 
Get sequence
Deep sequencing
2664 reads, 400 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr10: 35113341-35113449 [+]
sense
ENSSSCT00000025854 ; HNRNPK-201; intron 15
Database links

Mature sequence ssc-miR-7-5p

Accession MIMAT0002141
Sequence

23 - 

uggaagacuagugauuuuguuguu

 - 46

Get sequence
Deep sequencing4545 reads, 15 experiments
Evidence experimental; Illumina [1-2]

Mature sequence ssc-miR-7-3p

Accession MIMAT0037317
Sequence

65 - 

caacaaaucacagucugccaua

 - 86

Get sequence
Deep sequencing38 reads, 13 experiments
Evidence experimental; Illumina [4]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
4
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).