Stem-loop sequence ssc-mir-326

AccessionMI0002434 (change log)
DescriptionSus scrofa miR-326 stem-loop
Gene family MIPF0000143; mir-326
Literature search

4 open access papers mention ssc-mir-326
(5 sentences)

Stem-loop
   ----       g            c       uugu c     gg   u 
5'     ucugucu uugggcuggagg agggccu    g aggcg  uug g
       ||||||| |||||||||||| |||||||    | |||||  |||  
3'     aggcgga gacccgaccucc ucccggg    c uccgc  gac c
   acuu       -            u       ---u -     ua   u 
Get sequence
Deep sequencing
28 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 10800191-10800281 [-]
intergenic
Database links

Mature sequence ssc-miR-326

Accession MIMAT0002140
Sequence

56 - 

ccucugggcccuuccuccag

 - 75

Get sequence
Deep sequencing26 reads, 9 experiments
Evidence experimental; Illumina [2]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).