Stem-loop sequence ssc-mir-323

AccessionMI0002433 (change log)
DescriptionSus scrofa miR-323 stem-loop
Gene family MIPF0000018; mir-154
Literature search

7 open access papers mention ssc-mir-323
(11 sentences)

Stem-loop
   ---uu      u g        g u     gcgc  u    uua 
5'      gguacu g agagaggu g ccgug    gu cgcu   u
        |||||| | |||||||| | |||||    || ||||    
3'      cuaugg c uuucucca c ggcac    ca gcgg   u
   cuaau      - g        g u     auua  c    uau 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-323

Accession MIMAT0002139
Sequence

50 - 

gcacauuacacggucgaccucu

 - 71

Get sequence
Deep sequencing19 reads, 7 experiments
Evidence experimental; Illumina [2]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).