Stem-loop sequence ssc-mir-29b-1

AccessionMI0002431 (change log)
Previous IDsssc-mir-29b
DescriptionSus scrofa miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Literature search

28 open access papers mention ssc-mir-29b-1
(68 sentences)

Stem-loop
   -         -          u      gu      uuaaa 
5'  cuucaggaa gcugguuuca auggug  uuagau     a
    ||||||||| |||||||||| ||||||  ||||||     a
3'  gggguucuu ugacuaaagu uaccac  gaucug     g
   g         g          u      --      uuagu 
Get sequence
Deep sequencing
605 reads, 7.14 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr18: 19034822-19034902 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-29b-1
ssc-mir-29b-1chr18: 19034822-19034902 [+]
ssc-mir-29achr18: 19035225-19035310 [+]
Database links

Mature sequence ssc-miR-29b

Accession MIMAT0002137
Sequence

51 - 

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Deep sequencing1057 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).