Stem-loop sequence ssc-mir-28

AccessionMI0002430 (change log)
DescriptionSus scrofa miR-28 stem-loop
Gene family MIPF0000057; mir-28
Literature search

8 open access papers mention ssc-mir-28
(14 sentences)

Stem-loop
      c         a                u  aguugccuu 
5' ggu cuugcccuc aggagcucacagucua ug         u
   ||| ||||||||| |||||||||||||||| ||          
3' uca ggacgggag uccucgaguguuagau ac         c
      c         g                c  cccuucugu 
Get sequence
Deep sequencing
3441 reads, 107 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr13: 135461289-135461374 [+]
sense
chrUScaf832: 169149-169234 [+]
sense
Database links

Mature sequence ssc-miR-28-5p

Accession MIMAT0002136
Previous IDsssc-miR-28
Sequence

14 - 

aaggagcucacagucuauugag

 - 35

Get sequence
Deep sequencing1884 reads, 15 experiments
Evidence experimental; Illumina [2-3]

Mature sequence ssc-miR-28-3p

Accession MIMAT0015211
Sequence

54 - 

cacuagauugugagcuccugga

 - 75

Get sequence
Deep sequencing1557 reads, 14 experiments
Evidence experimental; Illumina [2-4]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).