Stem-loop sequence ssc-mir-24-1

AccessionMI0002428 (change log)
Previous IDsssc-mir-24
DescriptionSus scrofa miR-24-1 stem-loop
Gene family MIPF0000041; mir-24
Literature search

33 open access papers mention ssc-mir-24-1
(81 sentences)

Stem-loop
   cucugccu  c  g   a         aaca     gauu 
5'         cc gu ccu cugagcuga    caguu    u
           || || ||| |||||||||    |||||     
3'         gg ca gga gacuugacu    gucag    g
   --------  a  a   c         --cg     acgu 
Get sequence
Deep sequencing
53753 reads, 9.43e+03 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 65582174-65582245 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-24-1
ssc-mir-23achr2: 65581838-65581907 [+]
ssc-mir-27achr2: 65582015-65582096 [+]
ssc-mir-24-1chr2: 65582174-65582245 [+]
Database links

Mature sequence ssc-miR-24-1-5p

Accession MIMAT0015210
Previous IDsssc-miR-24*
Sequence

12 - 

gugccuacugagcugaaacacagu

 - 35

Get sequence
Deep sequencing99 reads, 13 experiments
Evidence experimental; Illumina [3,5-6]

Mature sequence ssc-miR-24-3p

Accession MIMAT0002134
Previous IDsssc-miR-24
Sequence

50 - 

uggcucaguucagcaggaacag

 - 71

Get sequence
Deep sequencing71534 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
3
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
5
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
6
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).