Stem-loop sequence ssc-mir-224

AccessionMI0002426 (change log)
DescriptionSus scrofa miR-224 stem-loop
Gene family MIPF0000088; mir-224
Literature search

7 open access papers mention ssc-mir-224
(13 sentences)

Stem-loop
          ca         u   u      a u   ag  u 
5' gggcuuu  agucacuag ggu ccguuu g aga  gu u
   |||||||  ||||||||| ||| |||||| | |||  || u
3' cccgaaa  ucagugauc ccg gguaaa c uuu  ua g
          ca         -   u      a -   gu  c 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 140860060-140860140 [-]
sense
ENSSSCT00000013944 ; GABRE-201; intron 6
Clustered miRNAs
< 10kb from ssc-mir-224
ssc-mir-452chrX: 140861113-140861192 [-]
ssc-mir-224chrX: 140860060-140860140 [-]
Database links

Mature sequence ssc-miR-224

Accession MIMAT0002132
Sequence

8 - 

caagucacuagugguuccguuua

 - 30

Get sequence
Deep sequencing10 reads, 6 experiments
Evidence by similarity; MI0000301

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).