Stem-loop sequence ssc-mir-217-1

AccessionMI0002425 (change log)
Previous IDsssc-mir-217
DescriptionSus scrofa miR-217-1 stem-loop
Gene family MIPF0000077; mir-217
Literature search

3 open access papers mention ssc-mir-217-1
(10 sentences)

Stem-loop
   auaauuauuacaga    uu     c c  a  c     c          u -   aag 
5'               guuu  gaugu g ag ua ugcau aggaacugau g gau   a
                 ||||  ||||| | || || ||||| |||||||||| | |||    
3'               caaa  cuacg c uc gu acgua uucuugacua c cug   a
   -----------gaa    -u     a u  c  u     a          c a   guu 
Get sequence
Deep sequencing
225 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr3: 90065707-90065813 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-217-1
ssc-mir-216-1chr3: 90058975-90059079 [+]
ssc-mir-217-1chr3: 90065707-90065813 [+]
Database links

Mature sequence ssc-miR-217

Accession MIMAT0002131
Sequence

32 - 

uacugcaucaggaacugauuggau

 - 55

Get sequence
Deep sequencing448 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).