Stem-loop sequence ssc-mir-20a

AccessionMI0002423 (change log)
Previous IDsssc-mir-20
DescriptionSus scrofa miR-20a stem-loop
Gene family MIPF0000001; mir-17
Literature search

15 open access papers mention ssc-mir-20a
(33 sentences)

Stem-loop
       c   -a                 g   -  uu 
5' guag acu  aagugcuuauagugcag uag ug  u
   |||| |||  ||||||||||||||||| ||| ||   
3' cguc uga  uucacgaguauuacguc auc au  a
       a   aa                 -   u  ug 
Get sequence
Deep sequencing
21939 reads, 3.92e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr11: 66610513-66610583 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-20a
ssc-mir-17chr11: 66610060-66610136 [+]
ssc-mir-18achr11: 66610195-66610286 [+]
ssc-mir-19achr11: 66610343-66610424 [+]
ssc-mir-20achr11: 66610513-66610583 [+]
ssc-mir-19b-1chr11: 66610642-66610721 [+]
ssc-mir-92a-1chr11: 66610762-66610841 [+]
Database links

Mature sequence ssc-miR-20a-5p

Accession MIMAT0002129
Previous IDsssc-miR-20
Sequence

8 - 

uaaagugcuuauagugcaggua

 - 29

Get sequence
Deep sequencing21901 reads, 15 experiments
Evidence experimental; Illumina [2,4], cloned [3]

Mature sequence ssc-miR-20a-3p

Accession MIMAT0037316
Sequence

44 - 

acugcauuaugagcacuuaaagu

 - 66

Get sequence
Deep sequencing38 reads, 9 experiments
Evidence experimental; Illumina [5]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).