Stem-loop sequence ssc-mir-19a

AccessionMI0002422 (change log)
DescriptionSus scrofa miR-19a stem-loop
Gene family MIPF0000011; mir-19
Literature search

15 open access papers mention ssc-mir-19a
(23 sentences)

Stem-loop
       u  u                 --      ---    ag 
5' gcag cc cuguuaguuuugcauag  uugcac   uaca  a
   |||| || |||||||||||||||||  ||||||   ||||  a
3' cguc gg gguagucaaaacguauc  aacgug   augu  g
       c  u                 ua      uug    aa 
Get sequence
Deep sequencing
33090 reads, 2.07e+04 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr11: 66610343-66610424 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-19a
ssc-mir-17chr11: 66610060-66610136 [+]
ssc-mir-18achr11: 66610195-66610286 [+]
ssc-mir-19achr11: 66610343-66610424 [+]
ssc-mir-20achr11: 66610513-66610583 [+]
ssc-mir-19b-1chr11: 66610642-66610721 [+]
ssc-mir-92a-1chr11: 66610762-66610841 [+]
Database links

Mature sequence ssc-miR-19a

Accession MIMAT0002128
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Deep sequencing33089 reads, 15 experiments
Evidence experimental; cloned [2], Illumina [3]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).