Stem-loop sequence ssc-mir-184

AccessionMI0002421 (change log)
DescriptionSus scrofa miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

5 open access papers mention ssc-mir-184
(7 sentences)

Stem-loop
   c       auc         c      ag     -    ug 
5'  cagucac   cccuuauca uuuucc  ccagc uuug  a
    |||||||   ||||||||| ||||||  ||||| ||||   
3'  guuagug   gggaauagu aagagg  gguug aaau  c
   a       gau         c      ca     u    cu 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 53883626-53883708 [+]
intergenic
chrUScaf2138: 214203-214285 [-]
intergenic
Database links

Mature sequence ssc-miR-184

Accession MIMAT0002127
Sequence

52 - 

uggacggagaacugauaagggu

 - 73

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; 454 [2], Illumina [3-5]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
3
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).