Stem-loop sequence ssc-mir-181b-2

AccessionMI0002420 (change log)
Previous IDsssc-mir-181b
DescriptionSus scrofa miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

24 open access papers mention ssc-mir-181b-2
(46 sentences)

Stem-loop
   ---a   -     cucaa         cu           u  gu 
5'     ugg cugca     cauucauug  gucgguggguu ga  c
       ||| |||||     |||||||||  ||||||||||| ||  u
3'     acc ggcgu     guaaguaac  uagucacucaa cu  g
   acaa   a     caaac         --           -  aa 
Get sequence
Deep sequencing
1044 reads, 33.3 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 299324014-299324099 [+]
sense
ENSSSCT00000021314 ; ssc-mir-181b-2.1-201; exon 1
antisense
ENSSSCT00000029437 ; NR6A1-201; intron 2
Clustered miRNAs
< 10kb from ssc-mir-181b-2
ssc-mir-181a-2chr1: 299322152-299322231 [+]
ssc-mir-181b-2chr1: 299324014-299324099 [+]
Database links

Mature sequence ssc-miR-181b

Accession MIMAT0002126
Sequence

13 - 

aacauucauugcugucgguggguu

 - 36

Get sequence
Deep sequencing3394 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
3
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).