Stem-loop sequence ssc-mir-148a

AccessionMI0002418 (change log)
DescriptionSus scrofa miR-148a stem-loop
Gene family MIPF0000056; mir-148
Literature search

27 open access papers mention ssc-mir-148a
(93 sentences)

Stem-loop
                 -  -a    cc    -   aa 
5' gaggcaaaguucug ag  cacu  gacu cug  u
   |||||||||||||| ||  ||||  |||| |||  a
3' cucuguuucaagac uc  guga  cuga gau  u
                 a  ac    --    a   ag 
Get sequence
Deep sequencing
43054 reads, 1.42e+04 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr18: 51216035-51216102 [+]
intergenic
chrUScaf1043: 80923-80990 [+]
intergenic
Database links

Mature sequence ssc-miR-148a-5p

Accession MIMAT0022920
Sequence

6 - 

aaaguucugagacacuccgacu

 - 27

Get sequence
Deep sequencing2012 reads, 15 experiments
Evidence experimental; Illumina [4]

Mature sequence ssc-miR-148a-3p

Accession MIMAT0002124
Previous IDsssc-miR-148a
Sequence

44 - 

ucagugcacuacagaacuuugu

 - 65

Get sequence
Deep sequencing41042 reads, 15 experiments
Evidence experimental; Illumina [2,4-5], cloned [3]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).