Stem-loop sequence ssc-mir-135-2

AccessionMI0002416 (change log)
Previous IDsssc-mir-135a-2
DescriptionSus scrofa miR-135-2 stem-loop
Gene family MIPF0000028; mir-135
Literature search

3 open access papers mention ssc-mir-135-2
(11 sentences)

Stem-loop
   a   aaa     ucua   c            u            u g a 
5'  gau   uucac    gug uuuauggcuuuu auuccuauguga a u a
    |||   |||||    ||| |||||||||||| |||||||||||| | | u
3'  cua   aagug    cau aaguaccgaagg uagggauguacu u a a
   a   -aa     -uua   a            -            c g a 
Get sequence
Deep sequencing
79 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr5: 90552047-90552146 [-]
intergenic
Database links

Mature sequence ssc-miR-135

Accession MIMAT0002121
Previous IDsssc-miR-135a-1
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Deep sequencing213 reads, 14 experiments
Evidence experimental; Illumina [2]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).