Stem-loop sequence ssc-mir-125b-2

AccessionMI0002414 (change log)
Previous IDsssc-mir-125b
DescriptionSus scrofa miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Literature search

22 open access papers mention ssc-mir-125b-2
(159 sentences)

Stem-loop
   a  aga   uu     uc  ug   c   a        -gg   u 
5'  cc   cuu  ccuag  cc  aga ccu acuuguga   uau u
    ||   |||  |||||  ||  ||| ||| ||||||||   |||  
3'  gg   gag  ggauc  gg  ucu gga ugaacacu   aug u
   a  --g   gc     ca  gu   c   c        aca   a 
Get sequence
Deep sequencing
13621 reads, 2.01e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-125b

Accession MIMAT0002120
Sequence

17 - 

ucccugagacccuaacuuguga

 - 38

Get sequence
Deep sequencing26891 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).