Stem-loop sequence ssc-mir-122

AccessionMI0002413 (change log)
Previous IDsssc-mir-122a
DescriptionSus scrofa miR-122 stem-loop
Gene family MIPF0000095; mir-122
Literature search

24 open access papers mention ssc-mir-122
(151 sentences)

Stem-loop
   c        -      gg       c           --u  c 
5'  cuuagcag agcugu  aguguga aaugguguuug   gu c
    |||||||| ||||||  ||||||| |||||||||||   ||  
3'  ggauuguc ucgaua  ucacacu uuaccgcaaac   ca a
   c        a      aa       a           uau  a 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 179916336-179916420 [-]
intergenic
Database links

Mature sequence ssc-miR-122-5p

Accession MIMAT0002119
Previous IDsssc-miR-122a
Sequence

15 - 

uggagugugacaaugguguuugu

 - 37

Get sequence
Deep sequencing12 reads, 6 experiments
Evidence experimental; 454 [2], Illumina [3-5]

Mature sequence ssc-miR-122-3p

Accession MIMAT0037315
Sequence

51 - 

aacgccauuaucacacuaaau

 - 71

Get sequence
Evidence experimental; Illumina [6]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
3
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
6
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).