Stem-loop sequence ssc-mir-106a

AccessionMI0002412 (change log)
DescriptionSus scrofa miR-106a stem-loop
Gene family MIPF0000001; mir-17
Literature search

12 open access papers mention ssc-mir-106a
(32 sentences)

Stem-loop
     u   cc      -        a  g     g   c  u 
5' cc ugg  guguaa aagugcuu ca ugcag uag uu u
   || |||  |||||| |||||||| || ||||| ||| || u
3' gg acc  uacauu uucacgaa gu acguc auc ag g
     u   au      c        c  a     -   u  a 
Get sequence
Deep sequencing
628 reads, 26.7 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 126200183-126200263 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-106a
ssc-mir-106achrX: 126200183-126200263 [-]
ssc-mir-18bchrX: 126200019-126200101 [-]
ssc-mir-20b-1chrX: 126199775-126199854 [-]
ssc-mir-19b-2chrX: 126199650-126199729 [-]
ssc-mir-92a-2chrX: 126199512-126199591 [-]
ssc-mir-363-1chrX: 126199347-126199426 [-]
Database links

Mature sequence ssc-miR-106a

Accession MIMAT0002118
Sequence

13 - 

aaaagugcuuacagugcagguagc

 - 36

Get sequence
Deep sequencing628 reads, 15 experiments
Evidence experimental; Illumina [2-3]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).