Stem-loop sequence ath-MIR447c

AccessionMI0002409 (change log)
DescriptionArabidopsis thaliana miR447c stem-loop
Gene family MIPF0000170; MIR447
Literature search

3 open access papers mention ath-MIR447c
(19 sentences)

Stem-loop
          a     c      u uu    a g   u  g      aca         a       c    -    g u        cu  g  cuu     u 
5' cauucuu auaua aauacu c  uuuc u cau aa ccccuu   augucgagu aacaaag augu gucc c aauauugu  uc ag   gguau u
   ||||||| ||||| |||||| |  |||| | ||| || ||||||   ||||||||| ||||||| |||| |||| | ||||||||  || ||   |||||  
3' guaagaa uauau uuauga g  aaag a gug uu ggggaa   uauagcuca uuguuuu uaca cagg g uuauggca  ag uc   uuaug u
          c     a      u uu    a g   u  g      gaa         g       c    g    g u        -u  -  ---     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 1523306-1523503 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR447c
ath-MIR447achr4: 1528134-1528370 [-]
ath-MIR447cchr4: 1523306-1523503 [-]
Database links

Mature sequence ath-miR447c-5p

Accession MIMAT0020346
Sequence

39 - 

ccccuuacaaugucgaguaaa

 - 59

Get sequence
Evidence experimental; Illumina [4]

Mature sequence ath-miR447c-3p

Accession MIMAT0002115
Previous IDsath-miR447c
Sequence

121 - 

uuggggacgacaucuuuuguug

 - 142

Get sequence
Evidence experimental; cloned [1], 5'RACE [2], 454 [3]

References

1
PMID:15851028 "microRNA-directed phasing during trans-acting siRNA biogenesis in plants" Allen E, Xie Z, Gustafson AM, Carrington JC Cell. 121:207-221(2005).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).